Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • br In the present study we examined the expression

    2020-07-29


    In the present study, we examined the expression of eight ANGPTLs in six human gastric cancer cell lines (two AFPGCs and four common types of gastric cancer cell lines). We explored how the proliferation, migration, invasion and tube formation ability changed in HUVECs treated with recombinant protein ANGPTL6 or AFPGC cellular super-natant. AFPGC cell lines were transfected with specific short hairpin RNAs. We also investigated how these changes in ANGPLT6 expression influenced AFPGC cell apoptosis, migration and invasion. Finally, we investigated whether the ANGPTL6 knockdown influenced the tumor growth in vivo.
    2. Materials and methods
    2.1. Cell lines and culture conditions
    Human gastric cancer Lovastatin were maintained in culture using RPMI 1640 medium (GIBCO, Carlsbad, USA) (AGS, MKN1, SGC-7901, MGC-
    803) supplemented with 10% fetal bovine serum (GIBCO) and 1% pe-nicillin/streptomycin (GIBCO). GCIY was maintained in MEM (GIBCO, Carlsbad, USA) supplemented with 10% FBS, and FU97 was maintained in DMEM (GIBCO, Carlsbad, USA) supplemented with 10% FBS. Human umbilical vein endothelial cells (HUVECs) were conducted in en-dothelial cell growth medium (Cedarlane, Burlington, NC). All cell lines were cultured in a humidified chamber supplemented with 5% CO2 at 37 °C. Experiments were conducted using cells at a logarithmic growth phase. Recombinant human angiopoietin-like protein 6 (Catalog Number: 8466-AN, R&D systems) was purchased.
    2.2. Western blotting analysis
    2.3. Quantitative real-time PCR (qRT-PCR)
    qRT-PCR was performed as previously described [20]. The in-formation regarding primers were ANGPTL1(forward prrimer:5′-GATT TAATGCCACCACCTGATC-3′ and reverse primer:5′-CTGTTT TCACACCATAACTGCA -3′), ANGPTL2 (forward prrimer:5′-AAGTG CACCTACACCTTCAT-3′ and reverse primer:5′- CTCATTGTTGAGCAGC TCTAGC -3′), ANGPTL3 (forward prrimer:5′-GATCACAAAGCAAAAGG ACACT-3′ and reverse primer:5′- GGTTGTTTTCTCCACACTCATC -3′), ANGPTL4(forward prrimer:5′- TCCTGGACCACAAGCACCTAG AC-3′ and reverse primer:5′- CGGTTGAAGTCCACTGAGCCATC -3′), ANGPTL5 (forward prrimer:5′- AATGCACTTAGGACG
    GTATTCA-3′ and reverse primer:5′- ATTTGCTAGACCACACTCG TTA-3′), ANGPTL6(forward prrimer:5′- ACAGAGTGGAGTGTA TGAA CTG-3′ and reverse primer:5′- AATAGGAGTCTCGGTC CCTATC -3′), ANGPTL7(forward prrimer:5′- CACTTTGTTTTGGGC AATGAAC-3′ and reverse primer:5′- TTTGAGGGAGTAGGTAGATCCA -3′), ANGPTL8(forward prrimer:5′- ATGGAGGAGG
    ATATTCTGCAG-3′ and reverse primer:5′- AAGACCTCAAATTCTCG GTAGG -3′), and universal probe the glyceraldehyde-3-phosphate de-hydrogenase (GAPDH) (forward prrimer 5′-AGCCACATCGC TCAGACAC-3′ and reverse primer 5′-GCCCAATACGACCAAA TCC-3′)
    2.4. Transfection with shRNA plasmid
    The following shRNA and vector controls were purchased from Shanghai GeneChem Co. Transfection was performed using Lipofectamine 200 according to the manufacturer’s instructions. ANGPLT6 shRNA (shANGPTL6) and the control shRNA (Ctrl) vectors were transfected into GCIY cells. After transfection, the cells were cultured in culture medium containing 3 mg/ml puromycin (Invitrogen, USA).
    2.5. In vitro HUVEC tube formation assay
    When the cells grew to 80% confluence, they were starved for 24 h (serum-free culture). After thawing at 4 °C overnight, 10 u l of Matrigel (growth factor reduced, BD Biosciences, USA) was precoated onto a u-Slide Angiogenesis (ibidi, USA) and Lovastatin then incubated at 37 °C for at least 2 h to conform Matrigel solidification. HUVECs at a density of 2 × 105 cells/ml in different culture conditions were seeded onto each u-slide. After incubation at 37 °C for 5 h, networks images were taken under an inverted microscope.
    2.6. HUVEC proliferation assay
    HUVECs during the logarithmic growth period were used for a proliferation assay. Then, 100 ul (2 × 103/well) cells were added to a 96-well plate and replenished in the conditioned medium after 24 h. Cell growth was calculated using a Cell Counting Kit-8 (CCK8) (Dojiindo, Kumamoto, Japan), according to the protocol provided by the manufacturer. The HUVECs were stained with 10 μl CCK8 for 2 h at 37 °C in a CO2 incubator for 24 h, 48 h, and 72 h, respectively. The spectrophotometric absorbance values at 450 nm (OD value) were measured by a microplate reader. All assays were performed in tripli-cate.
    2.7. Migration and invasion assays
    Migration and invasion assays were assessed using chambers with a size diameter of with 8 microns (Corning, USA). The upper chambers were separately inculated with 1 × 10 4 each type of cell. Then, the different conditioned media were added to the lower chamber. For the invasion experiment, the inner surface of the membrane was precoated with 100 μl of 1 mg/ml Matrigel (BD, USA) to form an artificial