Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • BBA General Subjects xxx xxxx xxx

    2019-09-16

     BBA - General Subjects xxx (xxxx) xxx–xxx
    and analyzed with the chi-squared logrank test for trend at α = 0.05. Throughout the study, animals were monitored for signs of hy-percalcemia, such as changes in appetite or lethargy.
    On the day of harvest, animals were euthanized with CO2 and me-tastases were identified by the presence of RFP (443/581 nm) using a Zeiss SteroDiscovery.V12 fluorescence dissecting microscope with an AxioCam MRm digital camera. Tumors were harvested and analyzed with μCT. Axial and ATPγS tetralithium salt inguinal lymph nodes, lungs, and livers were grossly examined for RFP expression. Fluorescing organs were har-vested and fresh flash-frozen on block dry ice in optimal cutting tem-perature compound (OCT) (#25608; VWR, Radnor, PA) for histological analysis. After μCT analysis, tumors were fresh flash-frozen in OCT as above. OCT-embedded samples were cut into 3-5 μm sections on a cryostat, post-fixed with fresh 4% paraformaldehyde for 10 min, and stained with H&E to confirm metastasis. Total metastatic incidence and metastatic incidence by organ were recorded.
    2.3.1. Response to vitamin D3 metabolites
    2.3.1.1. Signaling pathway inhibition. In these experiments, ATPγS tetralithium salt were pre-treated for 30 min with inhibitors or vehicle in warm complete media. At that time, fresh media containing 24R,25(OH)2D3 or vehicle were added on top of inhibitor treatments, and cells were incubated for a further 15 min before the conditioned media were aspirated. Cultures were then incubated in fresh complete media until harvest. To determine if the effect of 24R,25(OH)2D3 was mediated by palmitoylation, cultures were pretreated with 1–10 μM 2-bromopalmitate (Sigma-Aldrich #21604) [67]. PLD was inhibited by pretreatment with 0.1 to 1 μM wortmannin (VWR #80055508, Radnor, PA) [46]. To assess whether intact caveolae were required, cultures were pretreated with 1 or 10 mM methyl β-cyclodextrin (Sigma-Aldrich #C4555) in serum-free media to deplete cell membranes of cholesterol [68–70]. In order to assess the role of ERα66, cultures were pretreated with 10−7 M ICI-182780, an inhibitor to cytosolic and nuclear ERs (Sigma-Aldrich #I4409) [71,72]. The contribution of ERα36 was determined by pretreating MCF7 cells with 1 μg of a neutralizing antibody to the membrane-associated estrogen receptor (Chi Scientific #8–80,113, purchased from VWR) [73].
    2.3.2.1. DNA synthesis. Cells were cultured to 70% confluence, then serum-starved for 48 h in phenol-red free MEM supplemented with 1% charcoal-dextran filtered FBS and 50 U/50 U penicillin-streptomycin. At that time, cells were treated with 24R,25(OH)2D3, 24S,25(OH)2D3, 25(OH)D3, or 1α25(OH)2D3 for 15 min and incubated with fresh complete media for 24 h. In a separate experiment, cells were treated with these vitamin D3 metabolites for 24 h. At the 20 h mark, cells in both experiments were pulsed with 10 μL of a 1:100 dilution of 5-ethynyl-2′-deoxyuridine (EdU) and incubated for 4 h. Cells were harvested and assayed for EdU incorporation according to the manufacturer's instructions (ThermoFisher Scientific #C10214).
    Table 1
    Human primers used in real-time PCR analysis.
    Gene Primer sequence
    BAX F GACGAACTGGACAGTAACATGG
    R AAAGTAGAAAAGGGCGACAACC CXCL12 F GCCTCTGAAGCCTATGTATG
    R GACGAACTGGACAGTAACATGG CXCR4 F TAGCAAAGTGACGCCGAGGG
    R TGGTTCTCCAGATGCGGTGG ERBB2 F CCGCTGAAGTCCACACAGTT
    R AAAGGTTCTACCCCGCATGG GAPDH F CTATAAATTGAGCCCGCAGCC
    R TGGCGACGCAAAAGAAGATG MMP1 F AGAAAGAAGACAAAGGCAAGTTGA
    R TCCCCAGTCACTTTCAGCCC TNFRSR11B F GTGTGCGAATGCAAGGAAGG
    R CACTCCAAATCCAGGAGGGC
    media for 15 min as described above. Cultures were then aspirated and incubated with complete media for 12 h. RNA was extracted using TriZol (Invitrogen, Carlsbad, CA) and quantified (Take3 Micro-Volume Plate, Biotek, Winooski, VT) before being used to synthesize cDNA libraries (High Capacity cDNA Reverse Transcription kit, Promega, Madison, WI). Apoptosis markers were B cell lymphoma protein 2-associated X protein (BAX) to B cell lymphoma protein 2 (BCL2) mRNA expression. Epithelial to mesenchymal transition markers were C-X-C-motif chemokine 12 (CXCL12), chemokine receptor type 4 (CXCR4), snail family transcriptional repressor 1 (SNAI1), erythroblastic oncogene B (ERBB2), and matrix metalloproteinase 1 (MMP1). Markers of metastasis were osteoprotegerin (OPG), and nuclear factor kappa-B ligand (RANKL) [74–77].