Archives

  • 2019-07
  • 2019-08
  • 2019-09
  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Materials and methods br obtained from

    2020-08-30


    2. Materials and methods
    obtained from the American Type Culture Collection (ATCC). The TGF-β-sensitive Mv1Lu cell line was donated by Dr. H. López Muñoz at the UIDCC, FES-Z, UNAM, México.
    To analyze the participation of the adenosinergic pathway in the secretion and expression of TGF-β in CeCa tumor cells, 1 × 105 tumor 12-Deoxycholyltaurine were cultured in 6-well plates for 96 h in the presence of different concentrations (1 μM, 10 μM, 100 μM and 1 mM) of AMP or Ado (Sigma-Aldrich, St. Louis, MO, USA). Samples of the supernatants were collected every 24 h to analyze TGF-β1 content. To block the interac-tion of Ado with A2AR and A2BR, 10 μM (final concentration) of the specific antagonists ZM241385 (Sigma-Aldrich) and MRS1754 (Sigma-Aldrich), respectively, were added 30 min before adding AMP or Ado to the cell cultures. Cultures were maintained in Opti-MEM medium (Gibco, CA, USA) supplemented with 1% bovine fetal serum (SFB; Gibco) dialyzed with a 12 kDa cut-off membrane (Sigma-Aldrich), 100 IU/ml of penicillin and 100 μg/ml streptomycin (Gibco) at 37 °C and 5% CO2.
    For induction of CD73, tumor cells were cultured in the presence of either 1 mM Ado or 20 ng/ml recombinant human TGF-β1 (rh-TGF-β1, PeproTech, Rocky Hill, NJ, USA). The effect of TGF-β was blocked by the addition of 2 μg/ml rabbit anti-human neutralizing antibody against TGF-β1, -β2, and -β3 (anti-TGF-β; R&D Systems, Minneapolis, MN, USA) or 25 μM SB505124 (Sigma-Aldrich), selective inhibitor of TGF-β type I receptors.
    To quantify TGF-β1 content in CeCa cell culture supernatants, the human TGF-β1 Quantikine ELISA Kit (R&D Systems) was used ac-cording to the manufacturer’s protocol.
    Fig. 2. CD73 inhibition in CeCa cells decreases Ado generation. CaSki and HeLa cells were transfected with the pSiren vector containing a specific siRNA for CD73 (pS/siRNA-CD73) to inhibit CD73 expression. CD73 expression in CaSki-pS/siRNA-CD73 and HeLa-pS/siRNA-CD73 cells was analyzed by flow cytometry (A, C) and quantitative RT-PCR (B, D). (F) The enzymatic activity of CD73 of CaSki-pS/siRNA-CD73 and HeLa-pS/siRNA-CD73 cells was analyzed by TLC and compared with that of their respective wild type (wt) cells. Significant difference are indicated *(p < 0.05) and ****(p < 0.0001) with respect to wt.
    2.4. mRNA expression
    To analyze the mRNA expression of TGF-β1, A2AR and A2BR in CeCa cells, RNA was extracted with TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. cDNA was obtained from 500 ng of RNA with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). TGF-β1 mRNA expression was determined by quantitative RT-PCR, and A2AR and A2BR mRNA expression was determined by RT-PCR at end-point. G6PDH and β-actin genes were used as internal controls. Quantitative RT-PCR was performed using a Light Cycler 480 Real-Time PCR System (Roche Diagnostic, Manheim, Germany) and Universal ProbeLibrary 
    Probes (Roche Diagnostic). Each reaction was performed in a final volume of 10 μl according to the protocol suggested for the LightCycler
    480 Probe Master (Roche Diagnostic). The following primers were used: TGF-β1 Forward, 5′ACTACTACGCCAAGGAGGTCAC’3; TGF-β1 Reverse, 5′TGCTTGAACTTGTCATAGATTTCG’3; H6PD Forward, 5′ GCTACGCTCGGATCTTGTTC’3; and H6PD Reverse, 5′CCCAGTGCTTT TCGCTCT’3). Data were analyzed by the ΔCT relative quantification method. The end-point RT-PCR reaction was performed in a volume of 25 μl following the manufacturer’s instructions of the Master Mix PCR (Promega, Madison, WI, USA) using a TC1000-G (DLAB NT, Hong Kong). The amplified RT-PCR products were observed by 2% agarose gel electrophoresis (Invitrogen). The gel was stained with GelRed
    R. García-Rocha et al.
    Fig. 3. Ado generated by the hydrolysis of AMP is necessary to induce the production of TGF-β in CeCa cells. CaSki-pS/siRNA-CD73 and HeLapS/ siRNA-CD73 cells (1 × 105) were cultured in the presence of 1 mM AMP or Ado. After 96 h, TGF-β1 content was analyzed in the supernatants by ELISA. Data are representative of three independent experiments, and the averages ± SEM are
    shown. Significant differences in the content of TGF-β1 are indicated.
    (Biotium, Hayward, CA, USA), and an UV transilluminator (UVP Biodo-H System, Upland, CA, USA) was used to visualize the amplified pro-ducts. The following primers for A2AR, A2BR and β-actin were used: A2AR Forward, 5′TGACCGCTACATTGCCATC’3; A2AR Reverse, 5′TCC AACCTAGCATGGGAGTC’3; A2BR Forward, 5′TCTGTGTCCCGCTCA GGT’3; A2BR Reverse, 5′GATGCCAAAGGCAAGGAC’3; and β-actin Forward, 5′GGGTCAGAAGGATTCCTATG’3; and β-actin Reverse, 5′